Estructura y analisis del adn

Estructura y analisis del adn gy angelita0615 A2Ka5pR 02, 2010 7 pagcs TALLER ADN RECOMBINANTE El objetivo del siguiente taller es aplicar los conocimientos adquiridos durante los cursos de genética y biología molecular vistos durante la carrera. Vamos a encontrar preguntas básicas y aplicadas, donde el estudiante comprenderá la importancia de la biotecnología en diferentes áreas, como medicina, industria, agricultura, entre otras. PREGUNTAS 1. Qué es la Biotecno or7 to View nut*ge 2. Qué entiendes por genie principales problema ca? tos se sirve? áles son los geniería Genética 3. En qué se diferencian la Biotecnología y la ngeniería Genética? Razona la respuesta. 4. Qué es una enzima de restricción? Cuál es su actuación? 5. Dada la secuencia de ADN siguiente: … ATGCGAATTCCCGCCAGGTTATGCAATTCATG… … TACGCTTAAGGGCGCTCCAATACGTTAAGTAC… Cuántos y cuáles serían los fragmentos que originaría si se corta con la restrictasa EcoRl? con la restrictasa EcoRlI? es necesaria para insertar un fragmento de ADN en un plámido, o en el genoma de un virus o un cósmido? 10. 10.

Qué es una sonda de ADN?. De qué está formada y en qué propiedades se basa para la localización de segmentos de ADN? 1 . Qué razones justifican que la clonación se realice muy frecuentemente en células procaritas? 12. Qué ventajas presenta E. coli para ser el organismo más utilizado como hospedador en la clonación de genes? 13. para introducir vectores de clonación en células anmales y vegetales se emplean habitualmente dos técnicas: • Una consiste en introducir el ADN directamente en las células, a través de un capilar de diámetro muy pequeño.

Esta técnica se denomina • Otra técnica consiste en someter a las células suspendidas en una solución de ADN a impulsos eléctricos de alto voltaje, que lteran la membrana haciéndola más permeable al paso de ADN. Esta técnica se denomina 14. Los vectores de clonación deben llevar además del gen clonado, otro gen al que se le denomina «gen marcador» de fácil detección fenotípica. Qué tipo de genes podrían emplearse como marcadores? 15. Explicar las ventajas de utilizar la ADN-polimerasa de bacterias termófilas en la técnica del PCR? 16. Diseña un vector de clonación para clonar el gen de la insulina humana en una bacteria.

Comprueba posteriormente si la clonación se ha conseguido con éxito 17. Las endonucleasas de ORI V Hhal producidas por oli y Haemophilus haemolyticus respectivamente reconocen las siguientes secuencias y cortan por los puntos indicados con las flechas. Cuántas bases tendrán en cada caso los extremos cohesivos generados? [picl 18. Lee con atención el siguiente texto y contesta las preguntas que se formulan: El DAS, en colaboración con la Universidad, planea crear un banco de datos de ADN con el fin específico de lograr la identificación de personas desaparecidas.

El proyecto será financiado por nueve fundaciones que aportarán 356 millones. El banco de datos se creará con muestras de material genético, or ejemplo, sangre, cabellos, que proporcionen los familiares de las personas desaparecidas, lo que permitirá realizar el perfil genético de éstas. Sí, posteriormente, se encuentra un cadáver cuya identidad se desconoce, se procederá a hacer un cotejo con los datos existentes en el archivo de ADN, y en caso de estar fichado, se logrará identificar plenamente el fallecido. Qué técnica se utiliza para comparar diferentes muestras de ADN?.?

En qué se basa esta tecnología? Tras la lectura del texto antenor, qué problemas de carácter ético crees que se pueden derivar de la creación de bancos de datos de ADN humano? Dónde crees qué se deberían situar los limites? 19. Explica los efectos noci en tener algunos alimentos transgénicos y a deberse. fragmentos de ADN en una célula eucariota y clonarlos. 22. Por qué se dice que la bacteria Agrobacterium tumefaciens es un ingeniero genético de la naturaleza? 23. por qué y para qué se incorporan marcadores genéticos en los vectores de clonación?. 4. Qué condiciones debe reunir una célula hospedadora para considerarla adecuada en un proceso de clonación? 25. Los genomas de algunos virus bacterianos o fagos se emplean recuentemente como vectores de clonación. por qué no se pueden emplear como vectores de clonación en Sacharomyces cerevisae? 26. 26. De qué forma se utiliza la PCR en la identificación de un criminal?. 27. Actualmente, los diabéticos se inyectan insulina humana; sin embargo, hasta hace unos años se empleaba la insulina del cerdo, que difiere de la humana solamente en un aminoácido.

De qué modo ha influido la Biotecnología en este cambio? 28. Explica cómo se obtienen las vacunas recombinantes y pon algún ejemplo. 29. Qué función desempeñan las bacterias en la clonación de enes?. 30. Qué son las endonucleasas de restricción y para qué se emplean en ingeniería genética. 31 . 31 Por qué y para qué se incorporan marcadores genéticos en Imagina que eres un ingeniero genético y quieres obtener la proteína «Sabrosa». Qué pasos deberías dar para obtenerla mdiante manipulación genética?

Qué sorpresa se te podría presentar si hubieras llegado hasta la producción industrial de esta proteína y se te hubiera olvidado instalar el marcador al gen espec[fico?. 33. En 1 993, la prensa británica nos sorprendía con la siguiente noticia: «… Diez niños han muerto en Francia de la encefalopatía de Creutzfeldt-Jakob (enfermedad de las «vacas locas» humana ) y veinticinco están condenados como consecuencia de la administración de hormona de crecimiento infectada por priones».

El Instituto Pasteur de París habra extraído la hormona de crecimiento de hipófisis procedentes de países del este de Europa, sin suficiente control sanitario. Inmediatamente, las autoridades sanitarias españolas tranquilizaron a la población medlante un comunicado en el que se indicaba. «La hormona de crecimiento que se suministra en España se obtiene por ngeniería genética» Por qué podemos estar seguros de que la hormona del crecimiento obtenida por ingeniería genética no transmitirá dicha enfermedad?. Razona la respuesta. 4. Explica en qué consiste la «manipulación genética». Expón una posible aplicación en Agricultura. 35. Desde el punto de vista ético, propón un argumento a favor y otro en contra de la manipulación genética en los seres vivos. 36. La aplicación de técni la mejora de calidad, durac a molecular ha permitido SI_IF,• algunos productos consumimos. Explica con cierto detalle alguna de estas técnicas. 37. Explica por qué las vacunas recombinantes resultan más seguras que algunas vacunas fabricadas por métodos tradicionales. 38.

El esquema que se representa corresponde a un gel de secuenciación por el método del didesoxi. Cuál es la secuencia del ADN objeto de estudio? [pic] 39. Una molécula lineal de ADN de 1000 Pb de longitud es digerida con las siguientes enzimas de restricción, obteniéndose los siguientes resultados: Enzimas de restricción Fragmentos de restricción ECORI Bgl II ECORI+Bgl II 400 pb, 600 Pb 250 pb, 750 Pb 250 pb, 350 pb, 350 Pb Dibuja el mapa de restricción que se puede deducir de estos esultados. 40. Una pareja tienen un hijo con el síndrome de Down (trisomía del par 21).

Se realiza un análisis de RFLP con una sonda de cromosoma 21 en los tres individuos (padres e hijo) y el resultado del gel es el que se muestra en la figura. Qué se puede concluir acerca del origen de la enfermedad del niño? 41 . Crees qué deberían etiquetar en una marca de margarina fabricada con aceite de soja transgénica el origen del aceite usado. Razona la respuest crimen se encuentra entre las uñas de la víctima unos pocos pelos. A los dos días se detiene a un sospechoso de haber cometido dicho crimen. Se realiza por orden del juez, la prueba del ADN que se muestra.

Es el sospechoso autor del crimen de que le acusan? 45. Imagina que eres un cientifico al que le encargan que procure que no desaparezca una especie de planta en peligro de extincion. Que estrategias utilizarias? 46. La oveja Dolly es una oveja clonica y transgenica obtenida en 1997. Que procesos han llevado a su obtencion? BIBLIOGRAFIA • AYALA & KIGER. 1984. Genética moderna. Editorial omega • GRIFFI HS A. J. F, GELBARTW. M. , MILLERJ. H. y LEWONTIN R. C. (1999) Genética Moderna. McGraw-Hill/lnteramericana • KLUG W. S. y CUMMINGS MR (1999). onceptos de Genética. Ed. Prentice Hall Iberia, Madrid. • Genes V ó VI ó VII – Lewln, B. , Oxford university press. • Molecular cloning. (vols. 1, 2 y 3). Sambrook and Russell • PUERTAS. M. J. 1999. Genética, fundamentos y perspectivas. Editorial Interamericana. • SMITH & WOOD. 1998. Biología molecular y biotecnología. Editorial Adisson-WeesIy Iberoamericana. WEB http://wwwl. embl-heidelberg. de/ http://au. expasy. org/ http://www. cellbio. com/ http://www. horizonpress. com/gateway/ http://www. ornl. gov/sci/te Human Genome ‘education/education. shtm